Merge branch 'issue-24' into develop

* issue-24:
  Increment version number to 0.0.0.9029
  Disabled FASTA tests on greedyMix() (#24)
  Added synthetic FASTA file (#24)
  Ensure diffInCounts returns as.matrix (#24)
  Adapted tests to FASTA on greedyMix() (#24)
  Removed baps file pointing to fasta
  Improved conversion from FASTA to BAPS (#24)
  Improved handling of FASTA data (#24)
  `process_BAPS_data()` can handle file being an R object
  Added function to convert from FASTA to BAPS (#24)
  Unwrapped `greedyMix() example (#24)

DESCRIPTION

@@ -1,6 +1,6 @@
 Package: rBAPS
 Title: Bayesian Analysis of Population Structure
-Version: 0.0.0.9028
+Version: 0.0.0.9029
 Date: 2020-11-09
 Authors@R:
     c(
@@ -36,7 +36,7 @@ Description: Partial R implementation of the BAPS software
 License: GPL-3
 BugReports: https://github.com/ocbe-uio/rBAPS/issues
 Encoding: UTF-8
-RoxygenNote: 7.3.1
+RoxygenNote: 7.3.2
 Suggests:
     testthat (>= 2.1.0)
 Imports:

NAMESPACE

@@ -1,5 +1,6 @@
 # Generated by roxygen2: do not edit by hand
 
+export(convert_FASTA_to_BAPS)
 export(greedyMix)
 export(handleData)
 export(importFile)

R/computeDiffInCounts.R

@@ -13,5 +13,5 @@ computeDiffInCounts <- function(rows, max_noalle, nloci, data) {
       diffInCounts[element] <- diffInCounts[element] + 1
     }
   }
-  return(diffInCounts)
+  return(as.matrix(diffInCounts))
 }

R/convert_FASTA_to_BAPS.R

@@ -0,0 +1,16 @@
+#' @title Convert from FASTA to BAPS
+#' @description Converts a file (not an R object) from FASTA to BAPS format
+#' @param file filename of FASTA file
+#' @return `data` in BAPS format
+#' @author Waldir Leoncio
+#' @export
+#' @examples
+#' file <- system.file("extdata", "FASTA_clustering_haploid.fasta", package = "rBAPS")
+#' convert_FASTA_to_BAPS(file)
+convert_FASTA_to_BAPS <- function(file) {
+  data <- load_fasta(file) # Processing data
+  data <- cbind(data, seq_len(nrow(data))) # Add IDs of individuals (sequential)
+  data[data == 0] <- -9 # Because zeros (missing) in BAPS are coded as -9
+  colnames(data) <- paste("V", seq_len(ncol(data)), sep = "")
+  return(data)
+}

R/greedyMix.R

@@ -19,10 +19,8 @@
 #' with high-throughput sequencing data. <http://www.htslib.org/>
 #' @export
 #' @examples
-#' \dontrun{ # TEMP: unwrap once #24 is resolved
+#' data <- system.file("extdata", "BAPS_clustering_diploid.txt", package = "rBAPS")
-#' data <- system.file("extdata", "BAPS_format_clustering_diploid.txt", package = "rBAPS")
 #' greedyMix(data, "baps")
-#' } # TEMP: unwrap once #24 is resolved
 greedyMix <- function(
   data, format = gsub("^.*\\.", "", data), partitionCompare = NULL, npops = 3L,
   counts = NULL, sumcounts = NULL, max_iter = 100L, alleleCodes = NULL,
@@ -30,7 +28,8 @@ greedyMix <- function(
 ) {
   # Importing and handling data ================================================
   if (tolower(format) %in% "fasta") {
-    stop("FASTA format not yet supported on greedyMix")
+    data <- convert_FASTA_to_BAPS(data)
+    format <- "baps"
   }
   if (tolower(format) %in% "baps") {
     data <- process_BAPS_data(data, NULL)
@@ -69,7 +68,7 @@ greedyMix <- function(
   # Generating partition summary ===============================================
   ekat <- seq(1L, ninds * c[["rowsFromInd"]], c[["rowsFromInd"]])
   c[["rows"]] <- cbind(ekat, ekat + c[["rowsFromInd"]] - 1L)
-  logml_npops_partitionSummary <- indMixWrapper(c, npops, counts, sumcounts, max_iter, fixedK, verbose)
+  logml_npops_partitionSummary <- indMixWrapper(c, npops, counts, sumcounts, max_iter, fixedK, verbose) # FIXME: not working for FASTA data
   logml <- logml_npops_partitionSummary[["logml"]]
   npops <- logml_npops_partitionSummary[["npops"]]
   partitionSummary <- logml_npops_partitionSummary[["partitionSummary"]]

R/handleData.R

@@ -30,6 +30,7 @@ handleData <- function(raw_data, format = "Genepop") {
     "bam"     = stop("BAM format not supported for processing yet")
   )
   data <- as.matrix(raw_data)
+
   dataApu <- data[, seq_len(nloci)]
   nollat <- matlab2r::find(dataApu == 0)
   if (!isempty(nollat)) {
@@ -54,9 +55,14 @@ handleData <- function(raw_data, format = "Genepop") {
     alleleCodes[, i] <- as.matrix(c(alleelitLokuksessaI, zeros(puuttuvia, 1)))
   }
 
-  for (loc in seq_len(nloci)) {
+  # This is where data gets converted to {1, 2, 3, 4} for {A, C, G, T}
-    for (all in seq_len(noalle[loc])) {
+  codes <- unique(as.vector(data[, -ncol(data)]))
-      data[matlab2r::find(data[, loc] == alleleCodes[all, loc]), loc] <- all
+  skip_conversion <- base::min(codes) == -9 && base::max(codes) == 4
+  if (!skip_conversion) {
+    for (loc in seq_len(nloci)) {
+      for (all in seq_len(noalle[loc])) {
+        data[matlab2r::find(data[, loc] == alleleCodes[all, loc]), loc] <- all
+      }
     }
   }
 

R/process_BAPS_data.R

@@ -2,14 +2,23 @@ process_BAPS_data <- function(file, partitionCompare) {
   if (!is.null(partitionCompare)) {
     cat('Data:', file, '\n')
   }
-  data <- read.table(file)
+
-  ninds <- testaaOnkoKunnollinenBapsData(data)  # for testing purposes?
+  # Importing data
+  if (is.character(file)) {
+    data <- read.table(file)
+  } else {
+    data <- file
+  }
+
+  ninds <- testaaOnkoKunnollinenBapsData(data)  # Checks if last column is ID
   if (ninds == 0) {
     warning('Incorrect Data-file.')
     return(NULL)
   }
+
   popnames <- NULL  # Dropped specification of population names (from BAPS 6)
 
+  # Processing data
   result <- handleData(data, format = "BAPS")
   data <- result$newData
   rowsFromInd <- result$rowsFromInd

inst/extdata/FASTA_clustering_haploid_ext.fasta

@@ -0,0 +1,39 @@
+>1
+AACGAAACGATCGCGTCACCGGAACGTTGTCCGTCTCGAATAGCACTGTGGGAACGTGTTTTACATTCGT
+TAGTAACATGGTCAGCTGCTCATCCGTATT
+
+>2
+ATCAGCAAACGAGAAGTTGCAGAGGTCTTTGGTTTGAGCATTGCCCCCATACAATCGACTTCTGGCCTGG
+AATGCACCACAAACATACCCCACAGGCTCG
+
+>3
+GCTTTTACTAAGGCCTATCGGATTCAACGTCACTAAGACTCGGCACTAACAGGCCGTTGTAAGCCGCTCT
+GTCTGAGTATGGATGGTGGAGGCGGAGCCG
+
+>4
+ACCTGGACCTCTGTATTAACGGCTGTGATTCTGAGGGGGGTATCGCAGCGCACTTTCTAGCTATATCACG
+CAAGGATAAAGTTCACCCATCACGTTGACC
+
+>5
+ACAATACGTCATCCACACCGCGCCTATGGAAGAATTTGCCCTTTCGGCGACAGCCCATGCTGTCAAGGAG
+GTAACATAGCTACCAGGTCCCATTCCAGGA
+
+>6
+TCCCCCCAGTGGACACGGCTCGGGTAATGCAGCTTACCTCAACGCTAACGCATTTGACAGTAGTGAATCA
+CGGGCAACGCTGGGTGATTGCAAGTTTTGT
+
+>7
+GCAACCACTGGTCGCCTGGAGCATTGATCAGGAACATGTCTGCAAGGGGGGCCGTTGCGGGTTTCAGTCA
+TCGTATTGCGCTGCAAATCCTCGGAGCCTC
+
+>8
+CACCCGTAAAGCACGAGTAGGTTTCACCGCGACTTATATATTCCACCATACGGTTAACAAGGCAACACTT
+ATTCGTCGTCCAATGATCGTCCCTCTCCAG
+
+>9
+CGAATCCATTCGGGATAAAGTTAATACGTAAGTCGAACGGGGTTTAGGAAGAGCTCTGCTGTTAAGCGCG
+CTTATCATCTTATATGTGTCAGTTGTGTAC
+
+>10
+CGTTCGCATTTATAGGATATCCCCTAAACTAATTGGTAGTGATGGTATACCAGCGGTGCATTGTCCTCGC
+CTGTAGTTTAAGTCAACCTCTGCCTTAATC

man/convert_FASTA_to_BAPS.Rd

@@ -0,0 +1,24 @@
+% Generated by roxygen2: do not edit by hand
+% Please edit documentation in R/convert_FASTA_to_BAPS.R
+\name{convert_FASTA_to_BAPS}
+\alias{convert_FASTA_to_BAPS}
+\title{Convert from FASTA to BAPS}
+\usage{
+convert_FASTA_to_BAPS(file)
+}
+\arguments{
+\item{file}{filename of FASTA file}
+}
+\value{
+`data` in BAPS format
+}
+\description{
+Converts a file (not an R object) from FASTA to BAPS format
+}
+\examples{
+file <- system.file("extdata", "FASTA_clustering_haploid.fasta", package = "rBAPS")
+convert_FASTA_to_BAPS(file)
+}
+\author{
+Waldir Leoncio
+}

man/greedyMix.Rd

@@ -48,10 +48,8 @@ greedyMix(
 Clustering of individuals
 }
 \examples{
-\dontrun{ # TEMP: unwrap once #24 is resolved
+data <- system.file("extdata", "BAPS_clustering_diploid.txt", package = "rBAPS")
-data <- system.file("extdata", "BAPS_format_clustering_diploid.txt", package = "rBAPS")
 greedyMix(data, "baps")
-} # TEMP: unwrap once #24 is resolved
 }
 \references{
 Samtools: a suite of programs for interacting

tests/testthat/test-greedyMix.R

@@ -46,10 +46,6 @@ raw_bam <- importFile(
   data    = file.path(path_inst, "bam_example.bam"),
   format  = "BAM",
 )
-raw_baps <- importFile(
-  data   = file.path(path_inst, "FASTA_clustering_haploid.fasta"),
-  format = "FASTA"
-)
 
 test_that("Files are imported correctly", {
   expect_equal(dim(raw_fasta), c(5, 99))
@@ -61,13 +57,6 @@ test_that("Files are imported correctly", {
     )
   )
   expect_equal(length(raw_bam[[1]]), 13)
-  expect_error(
-    greedyMix(
-      data   = file.path(path_inst, "FASTA_clustering_haploid.fasta"),
-      format = "FASTA"
-    ),
-    "FASTA format not yet supported on greedyMix"
-  )
 })
 
 test_that("greedyMix() fails successfully", {
@@ -77,6 +66,7 @@ test_that("greedyMix() fails successfully", {
 
 test_that("greedyMix() works when it should", {
   baps_file <- file.path(path_inst, "BAPS_clustering_diploid.txt")
+  fasta_file <- file.path(path_inst, "FASTA_clustering_haploid.fasta")
   greedy_baps <- greedyMix(baps_file, "BAPS")
   expect_type(greedy_baps, "list")
   expect_length(greedy_baps, 10L)