From 12edd330b9c3125d6a927d66a967866baa75bd2d Mon Sep 17 00:00:00 2001
From: Waldir Leoncio <w.l.netto@medisin.uio.no>
Date: Fri, 3 Sep 2021 09:09:09 +0200
Subject: [PATCH 1/2] Improved load_fasta validation

---
 R/load_fasta.R    | 9 ++++++---
 man/load_fasta.Rd | 2 +-
 2 files changed, 7 insertions(+), 4 deletions(-)

diff --git a/R/load_fasta.R b/R/load_fasta.R
index 8d6a547..209a7c3 100644
--- a/R/load_fasta.R
+++ b/R/load_fasta.R
@@ -12,7 +12,7 @@
 #' msa <- system.file("ext", "seqs.fa", package="rBAPS")
 #' snp.matrix <- load_fasta(msa)
 #'
-#' @author Gerry Tonkin-Hill
+#' @author Gerry Tonkin-Hill, Waldir Leoncio
 #' @seealso rhierbaps::load_fasta
 #' @importFrom ape read.FASTA as.DNAbin
 #' @export
@@ -37,8 +37,11 @@ load_fasta <- function(msa, keep.singletons=FALSE) {
   rownames(seqs) <- seq_names
   seqs[is.na(seqs)] <- "-"
 
-  if (nrow(seqs)<3) stop("Less than 3 sequences!")
-  warning("Characters not in acgtnACGTN- will be treated as missing (-)...")
+  # Validation -----------------------------------------------------------------
+  if (nrow(seqs) < 3) stop("Less than 3 sequences!")
+  if (any(!(as.vector(tolower(seqs)) %in% c("a", "c", "g", "t", "n", "-")))) {
+    warning("Characters not in acgtnACGTN- will be treated as missing (-)...")
+  }
 
   #Remove conserved columns
   conserved <- colSums(t(t(seqs)==seqs[1,]))==nrow(seqs)
diff --git a/man/load_fasta.Rd b/man/load_fasta.Rd
index 171bfb3..9b4c84c 100644
--- a/man/load_fasta.Rd
+++ b/man/load_fasta.Rd
@@ -27,5 +27,5 @@ snp.matrix <- load_fasta(msa)
 rhierbaps::load_fasta
 }
 \author{
-Gerry Tonkin-Hill
+Gerry Tonkin-Hill, Waldir Leoncio
 }

From 682555f8e36080c19fcc3b4b0d9738017e8887b5 Mon Sep 17 00:00:00 2001
From: Waldir Leoncio <w.l.netto@medisin.uio.no>
Date: Fri, 3 Sep 2021 09:10:21 +0200
Subject: [PATCH 2/2] Adapted greedyMix examples (closes #15)

---
 inst/ext/FASTA_clustering_haploid.fasta | 20 +++++++++++++++
 tests/testthat/test-greedyMix.R         | 33 ++++++++++++++-----------
 2 files changed, 38 insertions(+), 15 deletions(-)
 create mode 100644 inst/ext/FASTA_clustering_haploid.fasta

diff --git a/inst/ext/FASTA_clustering_haploid.fasta b/inst/ext/FASTA_clustering_haploid.fasta
new file mode 100644
index 0000000..9501482
--- /dev/null
+++ b/inst/ext/FASTA_clustering_haploid.fasta
@@ -0,0 +1,20 @@
+>1
+AACGAAACGATCGCGTCACCGGAACGTTGTCCGTCTCGAATAGCACTGTGGGAACGTGTTTTACATTCGT
+TAGTAACATGGTCAGCTGCTCATCCGTATT
+
+>2
+ATCAGCAAACGAGAAGTTGCAGAGGTCTTTGGTTTGAGCATTGCCCCCATACAATCGACTTCTGGCCTGG
+AATGCACCACAAACATACCCCACAGGCTCG
+
+>3
+GCTTTTACTAAGGCCTATCGGATTCAACGTCACTAAGACTCGGCACTAACAGGCCGTTGTAAGCCGCTCT
+GTCTGAGTATGGATGGTGGAGGCGGAGCCG
+
+>4
+ACCTGGACCTCTGTATTAACGGCTGTGATTCTGAGGGGGGTATCGCAGCGCACTTTCTAGCTATATCACG
+CAAGGATAAAGTTCACCCATCACGTTGACC
+
+>5
+ACAATACGTCATCCACACCGCGCCTATGGAAGAATTTGCCCTTTCGGCGACAGCCCATGCTGTCAAGGAG
+GTAACATAGCTACCAGGTCCCATTCCAGGA
+
diff --git a/tests/testthat/test-greedyMix.R b/tests/testthat/test-greedyMix.R
index eaedf24..dde5e54 100644
--- a/tests/testthat/test-greedyMix.R
+++ b/tests/testthat/test-greedyMix.R
@@ -1,15 +1,15 @@
 context("Auxiliary functions to greedyMix")
 
-# Defining the relative path to current inst ------------- #
+# Defining the relative path to current inst -----------------------------------
 if (interactive()) {
-	path_inst <- "../../inst/ext/BAPS_format_clustering_diploid.txt"
+	path_inst <- "../../inst/ext"
 } else {
-	path_inst <- system.file(
-		"ext", "BAPS_format_clustering_diploid.txt", package="rBAPS"
-	)
+	path_inst <- system.file("ext", "", package="rBAPS")
 }
+
+# Reading datasets -------------------------------------------------------------
 baps_diploid <- read.delim(
-	file = path_inst,
+	file = paste(path_inst, "BAPS_format_clustering_diploid.txt", sep="/"),
 	sep = " ",
 	header = FALSE
 )
@@ -35,15 +35,18 @@ test_that("handleData works as expected", {
 	expect_equal(data_obs, data_exp)
 })
 
-context("Opening files on greedyMix/load_fasta")
+context("Opening files on greedyMix")
 
-# # TODO: needs #12 to be fixed before this can be done without user intervention
-# greedyMix(
-# 	tietue = "inst/ext/ExamplesDataFormatting/Example data in BAPS format for clustering of diploid individuals.txt",
-# 	format = "BAPS",
-# 	savePreProcessed = FALSE
-# ) # Upper bounds 100 100
-# TODO #16: replace with load_fasta()
+df_fasta <- greedyMix(
+	data   = paste(path_inst, "FASTA_clustering_haploid.fasta", sep="/"),
+	format ="fasta"
+)
+# TODO: add example reading VCF
+# TODO: add example reading SAM
+# TODO: add example reading Genpop
+test_that("Files are imported correctly", {
+	expect_equal(dim(df_fasta), c(5, 99))
+})
 
 context("Linkage")
 
@@ -53,4 +56,4 @@ test_that("Linkages are properly calculated", {
 		object   = linkage(Y),
 		expected = matrix(c(2, 1, 7, 8, 4, 3, 5, 6, .2, .3, .3, .6), ncol=3)
 	)
-})
\ No newline at end of file
+})