max/ourMELONS
1
0
Fork 0
Code Issues 1 Pull requests Projects Releases Packages Wiki Activity Actions

Added source Matlab code for reference

Browse source
This commit is contained in:
Waldir Leoncio 2019-12-16 16:47:21 +01:00
parent b8af977117
commit b5d99903d2
186 changed files with 61405 additions and 1 deletions
Download patch file Download diff file Expand all files Collapse all files

3
matlab/ExampleData/spatial clustering of groups/Example coordinates for the spatial clustering.txt Normal file
View file

@ -0,0 +1,3 @@
3.1013610e+006 6.7104850e+006
3.1016310e+006 6.7101990e+006
3.1015790e+006 6.7101790e+006

10
matlab/ExampleData/spatial clustering of groups/Example data in BAPS format for group-wise clustering of diploid individuals.txt Normal file
View file

@ -0,0 +1,10 @@
-9 102 56 80 100 90 118 90 88 104 1
-9 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 1
86 102 56 80 102 -9 116 90 86 100 1
88 102 54 80 102 90 116 92 -9 100 2
88 102 56 80 100 90 118 90 -9 104 2
80 102 54 82 102 92 116 90 86 104 2
88 104 56 84 102 92 120 90 88 100 2
86 102 56 80 -9 90 116 90 86 100 3
88 102 54 80 -9 90 116 92 86 100 3

5
matlab/ExampleData/spatial clustering of groups/Example data in BAPS format for group-wise clustering of haploid individuals.txt Normal file
View file

@ -0,0 +1,5 @@
88 102 56 80 100 90 118 -9 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 2
86 102 56 80 102 90 116 90 86 100 2
88 102 -9 80 102 90 116 92 86 100 3

20
matlab/ExampleData/spatial clustering of groups/Example data in BAPS format for group-wise clustering of tetraploid individuals.txt Normal file
View file

@ -0,0 +1,20 @@
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 -9 56 84 102 92 120 90 88 100 1
86 -9 56 80 102 90 116 90 86 102 1
88 -9 56 84 102 92 120 90 88 100 1
86 -9 56 80 102 90 116 90 86 100 1
88 102 54 82 102 90 116 92 86 102 2
88 102 56 80 100 90 118 90 88 104 2
88 102 54 80 102 90 116 92 86 102 2
88 102 56 80 100 90 118 90 88 104 2
80 102 54 82 102 92 116 -9 86 104 2
88 104 56 84 102 92 120 -9 88 100 2
80 102 54 82 102 92 116 -9 86 104 2
88 104 56 84 102 92 120 -9 88 100 2
86 102 56 80 102 90 116 90 86 100 3
88 104 54 80 102 90 116 92 86 100 3
86 102 56 80 104 90 116 90 86 100 3
88 102 54 80 102 90 116 92 86 100 3

20
matlab/ExampleData/spatial clustering of groups/Example data in FASTA format for group-wise clustering of haploid individuals.fasta Normal file
View file

@ -0,0 +1,20 @@
>1
AACGAAACGATCGCGTCACCGGAACGTTGTCCGTCTCGAATAGCACTGTGGGAACGTGTTTTACATTCGT
TAGTAACATGGTCAGCTGCTCATCCGTATT
>2
ATCAGCAAACGAGAAGTTGCAGAGGTCTTTGGTTTGAGCATTGCCCCCATACAATCGACTTCTGGCCTGG
AATGCACCACAAACATACCCCACAGGCTCG
>3
GCTTTTACTAAGGCCTATCGGATTCAACGTCACTAAGACTCGGCACTAACAGGCCGTTGTAAGCCGCTCT
GTCTGAGTATGGATGGTGGAGGCGGAGCCG
>4
ACCTGGACCTCTGTATTAACGGCTGTGATTCTGAGGGGGGTATCGCAGCGCACTTTCTAGCTATATCACG
CAAGGATAAAGTTCACCCATCACGTTGACC
>5
ACAATACGTCATCCACACCGCGCCTATGGAAGAATTTGCCCTTTCGGCGACAGCCCATGCTGTCAAGGAG
GTAACATAGCTACCAGGTCCCATTCCAGGA

3
matlab/ExampleData/spatial clustering of groups/group names.txt Normal file
View file

@ -0,0 +1,3 @@
group_A
groupB
C

5
matlab/ExampleData/spatial clustering of groups/group partition for FASTA-format.txt Normal file
View file

@ -0,0 +1,5 @@
1
1
2
2
3

5
matlab/ExampleData/spatial clustering of individuals/Example coordinates for the spatial clustering (not unique).txt Normal file
View file

@ -0,0 +1,5 @@
3.1013610e+006 6.7104850e+006
3.1013610e+006 6.7104850e+006
3.1015790e+006 6.7101790e+006
3.1015910e+006 6.7100650e+006
3.1017660e+006 6.7104190e+006

5
matlab/ExampleData/spatial clustering of individuals/Example coordinates for the spatial clustering.txt Normal file
View file

@ -0,0 +1,5 @@
3.1013610e+006 6.7104850e+006
3.1011410e+006 6.7108850e+006
3.1015790e+006 6.7101790e+006
3.1015910e+006 6.7100650e+006
3.1017660e+006 6.7104190e+006

10
matlab/ExampleData/spatial clustering of individuals/Example data in BAPS format for clustering of diploid individuals.txt Normal file
View file

@ -0,0 +1,10 @@
-9 102 56 80 100 90 118 90 88 104 1
-9 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 2
86 102 56 80 102 -9 116 90 86 100 2
88 102 54 80 102 90 116 92 -9 100 3
88 102 56 80 100 90 118 90 -9 104 3
80 102 54 82 102 92 116 90 86 104 4
88 104 56 84 102 92 120 90 88 100 4
86 102 56 80 -9 90 116 90 86 100 5
88 102 54 80 -9 90 116 92 86 100 5

5
matlab/ExampleData/spatial clustering of individuals/Example data in BAPS format for clustering of haploid individuals.txt Normal file
View file

@ -0,0 +1,5 @@
88 102 56 80 100 90 118 -9 88 104 1
80 102 54 82 102 92 116 90 86 104 2
88 104 56 84 102 -9 120 90 88 100 3
86 102 56 80 102 90 116 90 86 100 4
88 102 -9 80 102 90 116 92 86 100 5

20
matlab/ExampleData/spatial clustering of individuals/Example data in BAPS format for clustering of tetraploid individuals.txt Normal file
View file

@ -0,0 +1,20 @@
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 -9 56 84 102 92 120 90 88 100 2
86 -9 56 80 102 90 116 90 86 102 2
88 -9 56 84 102 92 120 90 88 100 2
86 -9 56 80 102 90 116 90 86 100 2
88 102 54 82 102 90 116 92 86 102 3
88 102 56 80 100 90 118 90 88 104 3
88 102 54 80 102 90 116 92 86 102 3
88 102 56 80 100 90 118 90 88 104 3
80 102 54 82 102 92 116 -9 86 104 4
88 104 56 84 102 92 120 -9 88 100 4
80 102 54 82 102 92 116 -9 86 104 4
88 104 56 84 102 92 120 -9 88 100 4
86 102 56 80 102 90 116 90 86 100 5
88 104 54 80 102 90 116 92 86 100 5
86 102 56 80 104 90 116 90 86 100 5
88 102 54 80 102 90 116 92 86 100 5

20
matlab/ExampleData/spatial clustering of individuals/Example data in FASTA format for clustering of haploid individuals.fasta Normal file
View file

@ -0,0 +1,20 @@
>1
AACGAAACGATCGCGTCACCGGAACGTTGTCCGTCTCGAATAGCACTGTGGGAACGTGTTTTACATTCGT
TAGTAACATGGTCAGCTGCTCATCCGTATT
>2
ATCAGCAAACGAGAAGTTGCAGAGGTCTTTGGTTTGAGCATTGCCCCCATACAATCGACTTCTGGCCTGG
AATGCACCACAAACATACCCCACAGGCTCG
>3
GCTTTTACTAAGGCCTATCGGATTCAACGTCACTAAGACTCGGCACTAACAGGCCGTTGTAAGCCGCTCT
GTCTGAGTATGGATGGTGGAGGCGGAGCCG
>4
ACCTGGACCTCTGTATTAACGGCTGTGATTCTGAGGGGGGTATCGCAGCGCACTTTCTAGCTATATCACG
CAAGGATAAAGTTCACCCATCACGTTGACC
>5
ACAATACGTCATCCACACCGCGCCTATGGAAGAATTTGCCCTTTCGGCGACAGCCCATGCTGTCAAGGAG
GTAACATAGCTACCAGGTCCCATTCCAGGA

5
matlab/ExampleData/spatial clustering of individuals/individual indices in population.txt Normal file
View file

@ -0,0 +1,5 @@
1
1
2
2
3

3
matlab/ExampleData/spatial clustering of individuals/population names.txt Normal file
View file

@ -0,0 +1,3 @@
pop_A
popB
C