Merge branch 'issue-18' into develop

R/greedyMix.R

@@ -1,9 +1,11 @@
 #' @title Clustering of individuals
 #' @param data data file
-#' @param format Format of the data c("FASTA", "VCF" ,"SAM", or "GenePop")
+#' @param format Format of the data c("FASTA", "VCF" ,"BAM", or "GenePop")
 #' @param verbose if \code{TRUE}, prints extra output information
 #' @importFrom utils read.delim
 #' @importFrom vcfR read.vcfR
+#' @references Samtools: a suite of programs for interacting
+#' with high-throughput sequencing data. <http://www.htslib.org/>
 #' @export
 greedyMix <- function(data, format, verbose = TRUE) {
 	format <- tolower(format)
@@ -12,8 +14,14 @@ greedyMix <- function(data, format, verbose = TRUE) {
 	} else if (format == "vcf") {
 		out <- vcfR::read.vcfR(data, verbose = verbose)
 	} else if (format == "sam") {
-		stop("SAM files not yet supported." )
+		stop(
-		# TODO #18: implement load_sam()
+			"SAM files not directly supported. ",
+			"Install the samtools software and execute ",
+			"'samtools view -b in_file.sam > out_file.bam' to convert to BAM ",
+			"and try running this function again with 'format=BAM'"
+		)
+	} else if (format == "bam") {
+		out <- Rsamtools::scanBam(data)
 	} else if (format == "genepop") {
 		# TODO #19: implement load_genepop()
 		stop("GenePop files not yet supported." )

inst/ext/sam_example.sam

@@ -0,0 +1,12 @@
+@HD	VN:1.0	SO:coordinate
+@SQ	SN:1	LN:249250621	AS:NCBI37	UR:file:/data/local/ref/GATK/human_g1k_v37.fasta	M5:1b22b98cdeb4a9304cb5d48026a85128
+@SQ	SN:2	LN:243199373	AS:NCBI37	UR:file:/data/local/ref/GATK/human_g1k_v37.fasta	M5:a0d9851da00400dec1098a9255ac712e
+@SQ	SN:3	LN:198022430	AS:NCBI37	UR:file:/data/local/ref/GATK/human_g1k_v37.fasta	M5:fdfd811849cc2fadebc929bb925902e5
+@RG	ID:UM0098:1	PL:ILLUMINA	PU:HWUSI-EAS1707-615LHAAXX-L001	LB:80	DT:2010-05-05T20:00:00-0400	SM:SD37743	CN:UMCORE
+@RG	ID:UM0098:2	PL:ILLUMINA	PU:HWUSI-EAS1707-615LHAAXX-L002	LB:80	DT:2010-05-05T20:00:00-0400	SM:SD37743	CN:UMCORE
+@PG	ID:bwa	VN:0.5.4
+@PG	ID:GATK TableRecalibration	VN:1.0.3471	CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, CycleCovariate, DinucCovariate, TileCovariate], default_read_group=null, default_platform=null, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, exception_if_no_tile=false, ignore_nocall_colorspace=false, pQ=5, maxQ=40, smoothing=1
+1:497:R:-272+13M17D24M	113	1	497	37	37M	15	100338662	0	CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG	0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>>	XT:A:U	NM:i:0	SM:i:37	AM:i:0	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:37
+19:20389:F:275+18M2D19M	99	1	17644	0	37M	=	17919	314	TATGACTGCTAATAATACCTACACATGTTAGAACCAT	>>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9	RG:Z:UM0098:1	XT:A:R	NM:i:0	SM:i:0	AM:i:0	X0:i:4	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:37
+19:20389:F:275+18M2D19M	147	1	17919	0	18M2D19M	=	17644	-314	GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT	;44999;499<8<8<<<8<<><<<<><7<;<<<>><<	XT:A:R	NM:i:2	SM:i:0	AM:i:0	X0:i:4	X1:i:0	XM:i:0	XO:i:1	XG:i:2	MD:Z:18^CA19
+9:21597+10M2I25M:R:-209	83	1	21678	0	8M2I27M	=	21469	-244	CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT	<;9<<5><<<<><<<>><<><>><9>><>>>9>>><>	XT:A:R	NM:i:2	SM:i:0	AM:i:0	X0:i:5	X1:i:0	XM:i:0	XO:i:1	XG:i:2	MD:Z:35

man/greedyMix.Rd

@@ -9,10 +9,14 @@ greedyMix(data, format, verbose = TRUE)
 \arguments{
 \item{data}{data file}
 
-\item{format}{Format of the data c("FASTA", "VCF" ,"SAM", or "GenePop")}
+\item{format}{Format of the data c("FASTA", "VCF" ,"BAM", or "GenePop")}
 
 \item{verbose}{if \code{TRUE}, prints extra output information}
 }
 \description{
 Clustering of individuals
 }
+\references{
+Samtools: a suite of programs for interacting
+with high-throughput sequencing data. <http://www.htslib.org/>
+}

tests/testthat/test-greedyMix.R

@@ -38,20 +38,29 @@ test_that("handleData works as expected", {
 context("Opening files on greedyMix")
 
 df_fasta <- greedyMix(
-	data   = paste(path_inst, "FASTA_clustering_haploid.fasta", sep="/"),
+	data   = file.path(path_inst, "FASTA_clustering_haploid.fasta"),
 	format = "FASTA"
 )
 df_vcf <- greedyMix(
-	data    = paste(path_inst, "vcf_example.vcf", sep="/"),
+	data    = file.path(path_inst, "vcf_example.vcf"),
 	format  = "VCF",
 	verbose = FALSE
 )
-# TODO #17: add example reading VCF
+df_bam <- greedyMix(
-# TODO #18: add example reading SAM
+	data    = file.path(path_inst, "bam_example.bam"),
+	format  = "BAM",
+)
 # TODO #19: add example reading Genpop
 test_that("Files are imported correctly", {
 	expect_equal(dim(df_fasta), c(5, 99))
 	expect_equal(dim(df_vcf), c(variants = 2, fix_cols = 8, gt_cols = 3))
+	expect_error(
+		greedyMix(
+			data    = paste(path_inst, "sam_example.sam", sep="/"),
+			format  = "SAM",
+		)
+	)
+	expect_equal(length(df_bam[[1]]), 13)
 })
 
 context("Linkage")