max/ourMELONS
1
0
Fork 0
Code Issues 1 Pull requests Projects Releases Packages Wiki Activity Actions

Added example data

Browse source
This commit is contained in:
Waldir Leoncio 2020-05-06 06:21:14 +02:00
parent 3b0bd4c87f
commit bee595c164
26 changed files with 22474 additions and 0 deletions
Show stats Download patch file Download diff file Expand all files Collapse all files

BIN
data/ExamplesDataFormatting/Example MLST DNA sequence data in concatenated Excel format.xls Normal file
View file

Binary file not shown.

108
data/ExamplesDataFormatting/Example baseline data in GENEPOP format for Trained clustering.txt Normal file
View file

@ -0,0 +1,108 @@
Baseline data for trained clustering
1
2
3
4
5
6
7
8
9
10
POP
Area1_1, 1717 1111 0000 0404 0505 0606 0707 1212 0707 1212
Area1_2, 0909 1010 0505 0404 0505 1010 0707 1111 0707 1212
Area1_3, 0000 1010 1414 0404 0505 0606 1111 1212 0707 1212
Area1_4, 1111 1010 1515 0404 0101 0606 1313 1111 0707 0808
Area1_5, 0101 1010 1212 0404 0505 0606 0909 1212 0707 1212
Area1_6, 1111 1010 1414 0404 0505 0606 1111 1212 0707 1010
Area1_7, 1515 1010 0707 0404 0505 0606 0707 1212 0707 1212
Area1_8, 1515 1212 0606 0404 0505 0606 1616 1212 0707 1010
Area1_9, 0909 1010 1010 0404 0505 0606 1919 1212 0707 1010
Area1_10, 0000 0000 0000 0404 0505 0606 1111 1010 0707 0000
Area1_11, 0000 0000 0000 0404 0505 0505 1919 1212 0404 1111
Area1_12, 1515 1010 0606 0404 0505 0606 1616 1212 0202 1212
Area1_13, 1515 1010 1515 0404 0505 0606 0707 0606 0707 1212
Area1_14, 0505 1010 1919 0404 0202 0606 1111 1010 0202 1212
Area1_15, 1111 1010 1414 0404 0505 0606 1616 0606 0707 1212
Area1_16, 1515 1212 0000 0404 0505 0606 1919 1212 0707 1212
Area1_17, 1515 1010 1515 0404 0505 0606 1919 1212 0707 1212
Area1_18, 1515 1010 1212 0404 0505 0606 0909 1212 0707 1010
Area1_19, 1515 1212 0606 0404 0505 0606 1515 1212 0707 1212
Area1_20, 1717 1414 1717 0404 0505 0606 0808 1212 0707 0808
Area1_21, 1515 1212 1212 0404 0505 0606 0808 1818 0707 1212
Area1_22, 1313 1111 1212 0404 0505 0606 1313 1212 0707 1212
Area1_23, 1515 1212 1212 0404 0505 0606 1313 1010 0707 1212
Area1_24, 0000 0000 0000 0404 0505 0606 1919 1212 0404 0000
Area1_25, 0000 0000 0000 0404 0202 0101 1919 1919 0707 1212
Area1_26, 1313 1010 0202 0404 0505 0606 1717 1212 0707 1212
POP
Area2_1, 1706 0505 1212 0404 0606 0808 1309 1111 0909 1413
Area2_2, 1511 0707 1209 0404 0602 0808 1111 1004 0902 1310
Area2_3, 1711 0000 1412 0402 0000 0000 1913 1002 0000 1313
Area2_4, 1715 1515 1412 0404 0505 0604 1313 1010 1007 1309
Area2_5, 1515 1515 1412 0404 0505 0606 1515 1111 0707 0908
Area2_6, 1309 0000 1212 0404 0603 0802 1311 1204 0903 1309
Area2_7, 1313 0505 1212 0404 0606 0808 1616 1414 0909 1206
Area2_8, 1307 0707 1212 0404 0606 0808 1313 1004 0909 1313
Area2_9, 0000 1212 1209 0404 0505 0606 0000 1106 0707 1208
Area2_10, 1307 0000 1212 0404 0606 0806 1313 1005 0909 1111
Area2_11, 0000 0707 1409 0505 0606 0808 1616 1110 0909 1309
Area2_12, 1807 0000 1212 0505 0606 0000 0909 0401 0909 1309
Area2_13, 1511 1212 1212 0404 0505 0604 1313 1110 0707 1210
Area2_14, 1111 1515 1412 0505 0606 0808 1414 1004 0909 1313
Area2_15, 1817 0707 1212 0505 0707 0909 1111 1004 0909 1313
Area2_16, 1913 1511 1212 0404 0606 0000 0909 1212 0909 1313
Area2_17, 1515 0000 0000 0000 0505 1006 1313 1005 0707 1212
Area2_18, 0707 0606 1408 0404 0202 0101 1313 1615 0202 1307
Area2_19, 0707 1309 0909 0502 0202 0101 2009 1510 0202 0704
POP
Area3_1, 1507 0706 1212 0202 0202 0000 0905 1409 0202 0707
Area3_2, 1507 1313 1212 0202 0202 0101 1613 1510 0202 0807
Area3_3, 1313 1414 1212 0404 0202 0101 1909 1510 0202 0704
Area3_4, 1515 0909 1212 0502 0202 0101 1409 1210 0202 0807
Area3_5, 1515 0808 1212 0502 0202 0101 1111 1510 0202 1007
Area3_6, 1306 0909 1212 0202 0202 0101 0807 1512 0202 0707
Area3_7, 0000 1009 1212 0404 0202 0101 1109 0702 0202 0808
Area3_8, 1507 0606 1212 0404 0202 0101 1908 1409 0202 0707
Area3_9, 1515 0606 1212 0202 0202 0101 0909 1510 0202 1207
Area3_10, 1307 1010 1412 0202 0202 0101 1709 1615 0202 1207
Area3_11, 1307 1005 1212 0404 0202 0101 1709 1510 0202 0703
Area3_12, 1109 0902 1212 0404 0202 0101 0909 1002 0202 1207
Area3_13, 1307 0606 1412 0404 0202 0101 0807 1515 0202 1207
Area3_14, 1717 1407 1212 0404 0202 0101 1107 1409 0202 0805
Area3_15, 1307 1007 1412 0404 0505 0101 0909 0000 0202 0807
Area3_16, 1811 0000 1212 0404 0505 0000 1515 0707 0000 1212
Area3_17, 1907 1414 1512 0402 0705 0000 0000 0000 0909 1212
POP
Area4_1, 1311 2019 1212 0404 0505 0000 1919 0707 0707 1109
Area4_2, 1309 2018 1512 0404 0505 0000 1919 0808 0707 1111
Area4_3, 1509 2118 1212 0404 0505 0000 1515 0707 0707 1107
Area4_4, 1715 2221 1512 0404 0505 0000 1919 0707 0707 1111
Area4_5, 1515 2121 1512 0404 0505 0000 1515 0707 0606 0707
Area4_6, 1717 2222 1512 0404 0505 0000 1913 0707 0707 0907
Area4_7, 1715 2221 1512 0404 0505 0000 1313 0707 0606 1111
Area4_8, 1813 2320 1512 0404 0505 0000 1515 0707 0707 1107
Area4_9, 1311 2019 1512 0404 0505 0000 1515 0707 0707 1111
Area4_10, 1311 2019 1512 0000 0505 0000 1313 0707 0707 0909
Area4_11, 1111 2625 0000 0000 0505 0606 0707 0903 0505 0505
Area4_12, 0907 2724 0000 0404 0505 0605 1914 1105 0505 0707
Area4_13, 1511 1610 1212 0404 0505 0605 1513 1105 1107 0704
Area4_14, 1513 0404 1111 0404 0505 0606 1515 1111 1207 1107
Area4_15, 1311 1616 1212 0404 0505 0606 1313 1111 0707 1107
Area4_16, 1109 0606 1212 0404 0000 0000 1515 0902 0807 0505
Area4_17, 1107 1004 1506 0404 0505 0606 1515 1212 0707 1108
Area4_18, 1107 0904 1512 0404 0505 0606 1913 1105 1107 1107
Area4_19, 1109 1313 1212 0404 0505 0606 1915 1111 1007 1107
Area4_20, 1711 1604 1212 0404 0505 0606 1915 1212 1107 1007
Area4_21, 1111 0606 1515 0404 0505 0606 1707 1009 0807 0502
Area4_22, 1311 0603 1512 0404 0505 0606 1714 0707 0807 0501
POP
Area5_1, 0711 1212 1513 0202 0707 0808 1408 0000 0909 1210
Area5_2, 1118 0101 1212 0202 0803 0901 0808 0000 1101 1211
Area5_3, 1518 0000 1512 0404 0707 0806 0909 0000 0909 1212
Area5_4, 1309 0000 1512 0202 0606 0707 1508 0000 0808 1204
Area5_5, 0718 0000 1512 0402 0707 0806 0707 0000 0909 1208
Area5_6, 1818 1414 1212 0404 0707 0000 1916 0000 0909 1208
Area5_7, 1318 1313 1212 0404 0606 0000 1908 0000 0808 1008
Area5_8, 1818 0000 1212 0404 0000 0806 1616 0000 0808 1212

5
data/ExamplesDataFormatting/Example coordinates for the spatial clustering of DNA sequences.txt Normal file
View file

@ -0,0 +1,5 @@
3.1013610e+006 6.7104850e+006
3.1011410e+006 6.7108850e+006
3.1015790e+006 6.7101790e+006
3.1015910e+006 6.7100650e+006
3.1017660e+006 6.7104190e+006

10
data/ExamplesDataFormatting/Example coordinates for the spatial clustering.txt Normal file
View file

@ -0,0 +1,10 @@
3.1013610e+006 6.7104850e+006
3.1016310e+006 6.7101990e+006
3.1015790e+006 6.7101790e+006
3.1015910e+006 6.7100650e+006
3.1017660e+006 6.7104190e+006
3.1017500e+006 6.7106040e+006
3.1019250e+006 6.7092640e+006
3.1017430e+006 6.7094990e+006
3.1015240e+006 6.7097430e+006
0 0

10
data/ExamplesDataFormatting/Example data in BAPS format for clustering of diploid individuals.txt Normal file
View file

@ -0,0 +1,10 @@
-9 102 56 80 100 90 118 90 88 104 1
-9 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 2
86 102 56 80 102 -9 116 90 86 100 2
88 102 54 80 102 90 116 92 -9 100 3
88 102 56 80 100 90 118 90 -9 104 3
80 102 54 82 102 92 116 90 86 104 4
88 104 56 84 102 92 120 90 88 100 4
86 102 56 80 -9 90 116 90 86 100 5
88 102 54 80 -9 90 116 92 86 100 5

5
data/ExamplesDataFormatting/Example data in BAPS format for clustering of haploid individuals.txt Normal file
View file

@ -0,0 +1,5 @@
88 102 56 80 100 90 118 -9 88 104 1
80 102 54 82 102 92 116 90 86 104 2
88 104 56 84 102 -9 120 90 88 100 3
86 102 56 80 102 90 116 90 86 100 4
88 102 -9 80 102 90 116 92 86 100 5

20
data/ExamplesDataFormatting/Example data in BAPS format for clustering of tetraploid individuals.txt Normal file
View file

@ -0,0 +1,20 @@
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 -9 56 84 102 92 120 90 88 100 2
86 -9 56 80 102 90 116 90 86 102 2
88 -9 56 84 102 92 120 90 88 100 2
86 -9 56 80 102 90 116 90 86 100 2
88 102 54 82 102 90 116 92 86 102 3
88 102 56 80 100 90 118 90 88 104 3
88 102 54 80 102 90 116 92 86 102 3
88 102 56 80 100 90 118 90 88 104 3
80 102 54 82 102 92 116 -9 86 104 4
88 104 56 84 102 92 120 -9 88 100 4
80 102 54 82 102 92 116 -9 86 104 4
88 104 56 84 102 92 120 -9 88 100 4
86 102 56 80 102 90 116 90 86 100 5
88 104 54 80 102 90 116 92 86 100 5
86 102 56 80 104 90 116 90 86 100 5
88 102 54 80 102 90 116 92 86 100 5

10
data/ExamplesDataFormatting/Example data in BAPS format for group-wise clustering of diploid individuals.txt Normal file
View file

@ -0,0 +1,10 @@
-9 102 56 80 100 90 118 90 88 104 1
-9 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 1
86 102 56 80 102 -9 116 90 86 100 1
88 102 54 80 102 90 116 92 -9 100 2
88 102 56 80 100 90 118 90 -9 104 2
80 102 54 82 102 92 116 90 86 104 2
88 104 56 84 102 92 120 90 88 100 2
86 102 56 80 -9 90 116 90 86 100 3
88 102 54 80 -9 90 116 92 86 100 3

5
data/ExamplesDataFormatting/Example data in BAPS format for group-wise clustering of haploid individuals.txt Normal file
View file

@ -0,0 +1,5 @@
88 102 56 80 100 90 118 -9 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 104 56 84 102 -9 120 90 88 100 2
86 102 56 80 102 90 116 90 86 100 2
88 102 -9 80 102 90 116 92 86 100 3

20
data/ExamplesDataFormatting/Example data in BAPS format for group-wise clustering of tetraploid individuals.txt Normal file
View file

@ -0,0 +1,20 @@
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 102 56 80 100 90 118 90 88 104 1
80 102 54 82 102 92 116 90 86 104 1
88 -9 56 84 102 92 120 90 88 100 1
86 -9 56 80 102 90 116 90 86 102 1
88 -9 56 84 102 92 120 90 88 100 1
86 -9 56 80 102 90 116 90 86 100 1
88 102 54 82 102 90 116 92 86 102 2
88 102 56 80 100 90 118 90 88 104 2
88 102 54 80 102 90 116 92 86 102 2
88 102 56 80 100 90 118 90 88 104 2
80 102 54 82 102 92 116 -9 86 104 2
88 104 56 84 102 92 120 -9 88 100 2
80 102 54 82 102 92 116 -9 86 104 2
88 104 56 84 102 92 120 -9 88 100 2
86 102 56 80 102 90 116 90 86 100 3
88 104 54 80 102 90 116 92 86 100 3
86 102 56 80 104 90 116 90 86 100 3
88 102 54 80 102 90 116 92 86 100 3

20
data/ExamplesDataFormatting/Example data in FASTA format for clustering of haploid individuals.fasta Normal file
View file

@ -0,0 +1,20 @@
>1
AACGAAACGATCGCGTCACCGGAACGTTGTCCGTCTCGAATAGCACTGTGGGAACGTGTTTTACATTCGT
TAGTAACATGGTCAGCTGCTCATCCGTATT
>2
ATCAGCAAACGAGAAGTTGCAGAGGTCTTTGGTTTGAGCATTGCCCCCATACAATCGACTTCTGGCCTGG
AATGCACCACAAACATACCCCACAGGCTCG
>3
GCTTTTACTAAGGCCTATCGGATTCAACGTCACTAAGACTCGGCACTAACAGGCCGTTGTAAGCCGCTCT
GTCTGAGTATGGATGGTGGAGGCGGAGCCG
>4
ACCTGGACCTCTGTATTAACGGCTGTGATTCTGAGGGGGGTATCGCAGCGCACTTTCTAGCTATATCACG
CAAGGATAAAGTTCACCCATCACGTTGACC
>5
ACAATACGTCATCCACACCGCGCCTATGGAAGAATTTGCCCTTTCGGCGACAGCCCATGCTGTCAAGGAG
GTAACATAGCTACCAGGTCCCATTCCAGGA

8
data/ExamplesDataFormatting/Example of a BAPS formatted diploid sequence file for clustering with linked loci.txt Normal file
View file

@ -0,0 +1,8 @@
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 1
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 1
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 2
GTTATCTAC--GGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 2
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 3
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 3
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 4
GTTATCTAC--GGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 4

4
data/ExamplesDataFormatting/Example of a BAPS formatted haploid sequence file for clustering with linked loci.txt Normal file
View file

@ -0,0 +1,4 @@
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 1
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 2
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 3
GTTATCTAC--GGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 4

16
data/ExamplesDataFormatting/Example of a BAPS formatted tetraploid sequence file for clustering with linked loci.txt Normal file
View file

@ -0,0 +1,16 @@
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 1
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 1
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 1
GTTATTGACTCGGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 1
TATCTAC--GAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 2
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 2
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 2
GTTATCTAC--GGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 2
CTAACGCTTGAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 3
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 3
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 3
GTTATTGACTCGGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 3
TATCTAC--GAGCTTATTGCTGCAGCGCAGAAAGTAGGTAAAACGTGTGCATTCGTTGATGCGGAA 4
GCACTTGACCCTATCTACGCTCAAAAGCTTGGTGTTGATATTGACGCTTTGCTTGTATCTCAACCT 4
GATACGGGTGAACAAGCTCTAGAAATTTGTGATGCACTGGCTCGTTCAGGTGCTATCGATGTTCTT 4
GTTATCTAC--GGTTGCTGCACTAACACCT-AGCTGAGATCGA-GGCGAAATGGGCGATAGCCACA 4

8
data/ExamplesDataFormatting/Example of a fasta formatted sequence file for gene recA.txt Normal file
View file

@ -0,0 +1,8 @@
>RecA-1
CTAACGCTTGAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAACCTAACGCTTGAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAAC
>RecA-2
CTAACGCTTGAGCTTATTGCTGCAGCACAGA-AGTGGGCAAAACGTGTGCATTCGTCGATGCCTAACGCTTGAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAAC
>RecA-3
CTAACGC--GAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAACCTAACGCTTGAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAAC
>RecA-4
CTAACGCTTGAGCTTATTGCTGCAGCACAGA-AGTGGGCAAAACGTGTGCATTCGTCGATGCCTAACGCTTGAGCTTATT-CTGCAGCCAAATTCGTATGAAAATTGGTGTAATGTTCGGTAAC

3
data/ExamplesDataFormatting/Example of a file specifying gene boundaries for a concatenated sequence in BAPS format.txt Normal file
View file

@ -0,0 +1,3 @@
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750

10
data/ExamplesDataFormatting/Example of a partition file for admixture analysis based on user-specified populations.txt Normal file
View file

@ -0,0 +1,10 @@
1
1
2
2
2
2
2
3
3
3

5
data/ExamplesDataFormatting/Example of an MLST profile file for 6 genes.txt Normal file
View file

@ -0,0 +1,5 @@
ST Isolate Species Adk GyrB Hsp60 Mdh Pgi RecA
1 1A1 My. splendidone 1 1 1 1 1 1
2 1B1 A. dent 2 2 2 2 2 2
3 1B2 A. dent 3 3 3 3 3 3
4 1A5 D. gently 4 4 4 4 4 4

22145
data/ExamplesDataFormatting/Example of hierBAPS input in FASTA format.fa Normal file
View file

File diff suppressed because it is too large Load diff

BIN
data/ExamplesDataFormatting/Example of hierBAPS input in XLS format.xls Normal file
View file

Binary file not shown.

3
data/ExamplesDataFormatting/Example of sample population index file to be used with BAPS formatted data.txt Normal file
View file

@ -0,0 +1,3 @@
1
3
5

3
data/ExamplesDataFormatting/Example of sample population names file to be used with BAPS formatted data.txt Normal file
View file

@ -0,0 +1,3 @@
Example population 1
Example population 2
Example population 3

25
data/ExamplesDataFormatting/Example pre-grouped sample data in GENEPOP format for Trained clustering.txt Normal file
View file

@ -0,0 +1,25 @@
Sample data for trained clustering
1
2
3
4
5
6
7
8
9
10
POP
AreaUnknown_11, 1717 1010 1717 0404 0505 0606 0808 1010 0707 1212
AreaUnknown_12, 1515 1212 1414 0404 0505 0606 1919 1010 0707 1414
AreaUnknown_13, 1717 0303 1515 0404 0505 0606 1414 1010 0707 1212
POP
AreaUnknown_24, 1311 1205 1212 0302 0505 0606 1313 1005 0707 1107
AreaUnknown_25, 1306 0707 1212 0505 0603 0808 1109 1003 0000 0806
POP
AreaUnknown_36, 0909 0606 1212 0404 0606 0808 1717 1001 0909 1308
POP
AreaUnknown_47, 1507 1208 1212 0404 0202 0101 1915 1510 0202 0705
AreaUnknown_48, 1507 1313 1212 0202 0202 0101 1414 1510 0202 0704
AreaUnknown_49, 0907 0907 1212 0404 0202 0101 1908 0000 0202 1507
AreaUnknown_410, 1109 1918 1512 0505 0505 0000 1605 0706 0707 0505

31
data/ExamplesDataFormatting/Example sample data in GENEPOP format for Trained clustering.txt Normal file
View file

@ -0,0 +1,31 @@
Sample data for trained clustering
1
2
3
4
5
6
7
8
9
10
POP
AreaUnknown1, 1717 1010 1717 0404 0505 0606 0808 1010 0707 1212
POP
AreaUnknown2, 1515 1212 1414 0404 0505 0606 1919 1010 0707 1414
POP
AreaUnknown3, 1717 0303 1515 0404 0505 0606 1414 1010 0707 1212
POP
AreaUnknown4, 1311 1205 1212 0302 0505 0606 1313 1005 0707 1107
POP
AreaUnknown5, 1306 0707 1212 0505 0603 0808 1109 1003 0000 0806
POP
AreaUnknown6, 0909 0606 1212 0404 0606 0808 1717 1001 0909 1308
POP
AreaUnknown7, 1507 1208 1212 0404 0202 0101 1915 1510 0202 0705
POP
AreaUnknown8, 1507 1313 1212 0202 0202 0101 1414 1510 0202 0704
POP
AreaUnknown9, 0907 0907 1212 0404 0202 0101 1908 0000 0202 1507
POP
AreaUnknown10, 1109 1918 1512 0505 0505 0000 1605 0706 0707 0505

BIN
data/ExamplesDataFormatting/Example test data in XLS format for Trained clustering.xls Normal file
View file

Binary file not shown.

BIN
data/ExamplesDataFormatting/Example training data in XLS format for Trained clustering.xls Normal file
View file

Binary file not shown.